Task: 2
Task: 3
Task: 4
The Amplified PCR product was separated through agarose gel (1.2%) and checked by observing band size. The specific band of 867 bp was gel purified (A260/280 1.8) using QIAgen gel exctraction kit and quantified by NanoDrop™ 2000/2000c Spectrophotometers (Thermo Fisher Scientific). The purified and quantified DNA was Sequentialy digested with HINDIII and KpnI RE, that will generate compatible ends for cloning, similiarly the pcDNATM3.0 vector (Invitrogen, Carlsbad, CA, USA) is double digested with same set of RE in appropriate NEB RE buffer. The double digested products were ligated using NEB quick ligase kit. The ligated product was transformed into E. coli DH5? competent cells (Thermofisher Scientific, InvitrogenTM), grown on Amplicillin (100 ?g/ml) containing LB agar plates. The clones grown under ampicillin selection were further confirmed by colony PCR, double digestion with same set of restriction of RE and finally validated through sequencing by T7 or gene specific primer (GSP). The vector pcDNATM3.0 was chosen for transient expression in HL60 and MOLT-4 mammalian cell lines (BD Clontech, Palo Alto, CA; GeneTex, Inc. North America) under control of PCMV promoter. After confirmation in E.coli, the pcDNATM3.0::Molecule A, the entire cassette used to transfect HL-60 and MOLT-4 cell lines (BD Clontech, Palo Alto, CA).
The gene of interest were cloned into pcDNA 3.0 (Invitrogen, Carlsbad, CA, USA) for studying transient expression in mammalian as well as bacterial system under PCMV promoter and ampicillin selection marker.
The HL-60 and Molt-4 cell lines (mycoplasma negative) were used as model to study anti-leukemia effects of different molecules (A, B and C).
The HeLa cell lines were not used as they are contaminated with mycoplasma infection, while Molt-4 and HL-60 are contamination free. As presence of mycoplasma in cell culture will out compete for nutrients present in culture media leading to changed pattern f growth and protein production. Although mycoplasma infection is not visible and does not lead to any morphological changes but they have serious consequences such as reduced cellular ATP level, cytotoxity and culture starvation.
Likewise, the cDNA for Molecule B (BIRC5) was amplified using a proof reading platinum Taq DNA polymerase (ThermoFisher SCIENTIFIC, InvitrogenTM). The primer pairs were synthesized using NCBI Primer Tool. Primers were designed by keeping 50% GC content, 62°C Tm and avoiding any repeat and hairloop forming sequences. The HindIII and KpnI (F’ AAGCTTATGGGTGCCCCGACGTTGCC and R’ CACGCAGTTTTATCCGGTAAGGTACC) sites were included in the forward and reverse primers. As these restriction endonuclease (RE) sites are not present in nucleotide sequence of molecule B (https://tools.neb.com/NEBcutter2/index.php). Following reaction components were added sequentially and subjected to PCR conditions and amplification as described by manufacturer without any modification (Thermofisher Scientific, InvitrogenTM). The Amplified PCR product was separated through agarose gel (1.2%) and checked by observing band size. The specific band of 368 bp was gel purified (A260/280 1.8) using QIAgen gel exctraction kit and quantified by NanoDrop™ 2000/2000c Spectrophotometers (Thermo Fisher Scientific). The purified and quantified DNA was Sequentialy digested with HINDIII and KpnI RE, that will generate compatible ends for cloning, similiarly the pcDNATM3.0 vector (Invitrogen, Carlsbad, CA, USA) is double digested with same set of RE in appropriate NEB RE buffer. The double digested products were ligated using NEB quick ligase kit. The ligated product was transformed into DH5? cells (Thermofisher Scientific, InvitrogenTM), grown on Amplicillin containing LB agar plates. The clones grown under ampicillin (100 ?g/ml) selection were further confirmed by colony PCR, double digestion with same set of restriction of RE and finally validated through sequencing by T7 or gene specific primer (GSP). The vector pcDNATM3.0 was chosen for transient expression in HeLa mammalian cell lines (BD Clontech, Palo Alto, CA) under control of PCMV promoter. After confirmation in E.coli, the pcDNATM3.0::Molecule B, the entire cassette was transformed into HeLa cell lines (BD Clontech, Palo Alto, CA).
The pTRE-Tight-Molecule A and pTRE-Tight-Molecule B construct should be verified for functionality with DOX before starting development of Double-Stable Tet-On Advanced Inducible Cell Lines. Different gene specific assays has to be performed to test it’s transient expression in stable cell lines. These includes western blotting or immunoprecipitation with an Anti-molecule A or B antibody. The expression of each molecule is to be checked using quantitative real-time (qRT-PCR) using gene specific primers (Molecule A F’ 5-ACATTAGTGAGATATGGTTT-3, R’ 5-ACTGTCCATCTAAGGATGCA-3; Molecule B F’ 5-ACTGGCCCTTCTTGGAGGGC-3, R’ 5-TAGAGGAACATAAAAAGCAT-3) or Northern blotting using gene specific probe (Molecule A F’ 5-ATTAGTGAGATATGGT-3, R’ 5-TGTCCATCTAAGGATG-3; Molecule B F’ 5-TGGCCCTTCTTGGAGG-3, R’ 5-GAGGAACATAAAAAGC-3).
The pTRE-Tight-Molecule 5 vector is cotransfected with the pTRE-Tight-Molecule 5 vector along with linear selection marker onto Tet-On Advanced cell line. Transfection is done by Lipid-mediated gene delivery using lipofection or liposomes. Stable transfectants are screened by hygromycing or puromycin selection marker (2:1). The Tet-On Advanced cell lines will be plated at a particular cell density pH (>0.1 – 0.2 pH units). Afterwards. Transfected cells were seeded in 10cm plates containing minimal essential medium supplemented with G418 (100-200 ?g/ml). Transfected cells were allowed to divide twice for 24-28 hr before addition of hygromycin (200-400 ?g/ 4. ml) or puromycin (1-10 ?g/ml). The cells were grown under selection marker until the transfected colonies were visible and untransfected cells were dead, that will lead to effective colony isolation and selection. When large number of colonies have grown, transfected cells were transferred to cloning cylinder to further isolate large and single colonies, so they can be further transferred to individual plates or tissue culture wells. Harvest minimum of 30 colonies for testing of induction. Lastly, the individual double-stable cell line was tested for expression of molecule A and Bin the presence and absence of DOX. Those clones were choosen having highest overall induction, lowest basal expression and maximum fold expression. All clones were individually propagated into 6-well plates containing DOX and incubated for 48 hr. Transfected cells were harvested and assays were performed as described previously for expression of molecule A and B respectively.
The retroviral-based protein-fragment complementation assay (RePCA) will be utilized for the detection of context dependent protein-protein interactions, endogenous protein folding and post-translational modification in mammalian cell lines. The AcGFP1 will be inserted into the pBABEpuro vector, followed by splice donor, to generate a RePCA vector. The Tet-inducible promoter precludes latent toxicity of the fusion. The target HeLa cells and MOLT4 cells will be transfected, the retrovirus will endure transcription along with stable integration into the host DNA. If entire cassette gets inserted into the genome in-frame to downstream exons, then chances of full length gene expression will be increased. Those cell lines articulating tetracycline-regulated trans-activator, will permit the controlled expression of the pray (BIRC5) by Tet-inducible promoter, which is developed through transfection to express the AcGFP1-Bait (ATG5) fusion protein. Only those cells having RePCA fused in-frame to an interacting partner of the bait will fluoresce. The fluorescent cells will be cloned and the target genes will be identified directly by RT-PCR. The positive clones can be used straight forward to validate their function, localization and in-vivo mechanism.
The pBABE-puro vector was used as it’s a retroviral stable mammalian as well as bacterial expression vector under control of SV40 promoter where puromycin (0.25 ?g/ml) is for mammalian and kanamycin (50 ?g/ml) for bacterial selection.
The Tet-off advanced retroviral system is used as it is inducible, tightly regulated and give rise to robust as well as on-demand expression of gene of interest (GOI). Transfected cells expressing Tet-off transactivator along with a TRE expression vector, produces GOI in absence of antibiotic, doxycycline. The advanced tetracycline controlled transactivator is optimized for basal level expression of GOI in mammalian system. The coding sequence of advanced Tet-off is entirely synthetic and ues mammalian codon preference for stable and higher expression. The double-stable cell lines were selected on 90% Eagle’s Minimum Essential Medium (alpha modification), 10% Tet System Approved Fetal Bovine Serum (FBS) containing G418 (100 ?g/ml).
2. AcGFP1-Bait (ATG5) fusion protein HeLa Tet cells will be separate infected with pLEGFP-C1-BIRC5 retroviral vector. Subsequently, selection with puromycin and induction with doxycycline, different fluorescent cells will be selected via single and expanded fluorescence (due to difference in in-vivo localization.). On the basis of fluorescent pattern different clones will be identified for target fusion transcripts. Based on fluorescence pattern and intensity different clones will be further identified. This will demonstrate the possible interacting partners of ATG5 and BIRC5 in-vivo. The overexpressed molecule A has different localization pattern as compared to endogenous form of molecule A. The endogenous forms interacting partner is ATG-12, and the ATG-5:ATG12 activates a ubiquitin like conjugating sytem. Therefore, the edogenous form localizes in cytoskeleton, cytosol, mitochondira, lysosomes, plasma membrane etc. Whereas, the overexpressed Molecule A did not complex to it’s interacting partner ATG-12 therefore, shows different localization only in membrane as that of endogenous form.
The edogenous form of Molecule B has nuclear and cytoskeleton or mitotic chromosome localization whereas the overexpressed form has cytoplasmic localization. The post-translational modification i.e. acetylation and phosphorylation are necessary for its function and localization. The acetylated and phosphorylated form has anti-apoptic function, as acetylation leads to homodimerization while deacetylation leads to formation of monomers.
In-vivo localization studies of Molecule A and Molecule B fused to GFP needs to be performed to observe the difference between endogenous and overexpressed forms expression.
Further studies would be required to analyse the function and effect of interaction between Molecule A and Molecule B. As both molecules play significantly different roles, molecules A is involved in autophagy while molecule B is involved in anti-apoptosis and regulating cell cycle events.
3. Identification of signaling pathways of ATG5 and BIRC5 by antisense expression libraries. The antisense expression libraries can efficiently and explicitly hinder the expression of the ATG5 and BIRC5 genes. The differences in the cell signaling pathway of both molecules A and B will be assessed by RNAi (RNA intereference) and Cell Growth Assay. The antisense expression libraries of ATG5/BIRC5 will be transfected with ATG5/BIRC5 respectively. To get mutant mammalian cell lines, one must: (i) set up a selection or screen in which the expression of a marker gene is induced or in which constitutive expression is lost; (ii) mutagenize the cells; (iii) select mutant clones and characterize them for dominance and complementation of similarly derived but independent mutant clones; (iv) clone complementing DNAs from an expression library; (v) analyze expression of the mRNA and protein encoded by the complementing DNA in a set of similar but independent mutant clones; and (vi) select the best clone for a structure–function analysis of the role of the target protein in the pathway. A pool of siRNAs targeting human ATG5 (NM_001286106.1, NM_001286107.1) and BIRC5 (NM_001012270.1, NM_001012271.1) along with a nontargeting siRNA pool were from Dharmacon (Lafayette, CO). RNAi silencing was performed according to the manufacturer’s protocol . The kit comprises three dissimilar systems for observing GAPDH siRNA-induced knockdown. An anti-GAPDH antibody is present in kit to measure GAPDH protein concentration by western blot or immunofluorescence. The KDalert™ GAPDH helps to rapidly quantify GAPDH enzymatic activity. This assay was also used to assess cell viability. Lastly, RT-PCR primers are also supplied with the kit, for real-time quantitative RT-PCR detection of GAPDH mRNA using SYBR®Green. These reagents were also used to transfect miRNAs, such as the Ambion® Pre-miR™ miRNA Precursor Molecules. The effects of siRNA knockdown on cell growth was evaluated by a 3,(4,5-dimethylthiazol-2-yl) 2,5-diphenyltetrazolium bromide assay. There are numerous softwares that intended to use expression data to explicate or have an idea of the main signaling pathways disturbed when molecule A and molecule B are individually transfected...here is a small list (some free ware and some not): DAVID, Pathview, ONDEX, Cytoscape, Ingenuity (payr, but you can get a 1-weel trial to test it), Also from Ingenuity but free is TOPPGENE, G:Profiler, GPAT, KOBAS, GSEA "Gene Set Enrichment Analysis (GSEA) , ErmineJ , GAGE, EASE, VisANT.
Control: HL60 and MOLT4 cell lines only (non-transfectd cell lines)
4.The cDNA for Molecule C (E2F3P1) was amplified using a proof reading platinum Taq DNA polymerase (ThermoFisher SCIENTIFIC, InvitrogenTM). The primer pairs were synthesized using NCBI Primer Tool. Primers were designed by keeping 50% GC content, 62°C Tm and avoiding any repeat and hairloop forming sequences. The HindIII and KpnI (F’ AAGCTTATGGCCTTGGCCGGGGCCCC and R’ TCACCCCCCTGGATTTCTGAGGTACC) sites were included in the forward and reverse primers. As these restriction endonuclease (RE) sites are not present in nucleotide sequence of molecule A. Following reaction components were added sequentially and subjected to PCR conditions and amplification as described by manufacturer without any modification (Thermofisher Scientific, InvitrogenTM). The Amplified PCR product was separated through agarose gel (1.2%) and checked by observing band size. The specific band of 1381 bp was gel purified (A260/280 1.8) using QIAgen gel exctraction kit and quantified by NanoDrop™ 2000/2000c Spectrophotometers (Thermo Fisher Scientific). The purified and quantified DNA was Sequentialy digested with HINDIII and KpnI RE, that will generate compatible ends for cloning, similiarly the pcDNATM3.0 vector (Invitrogen, Carlsbad, CA, USA) is double digested with same set of RE in appropriate NEB RE buffer. The double digested products were ligated using NEB quick ligase kit. The ligated product was transformed into E. coli DH5? competent cells (Thermofisher Scientific, InvitrogenTM), grown on Amplicillin (100 ?g/ml) containing LB agar plates. The clones grown under ampicillin selection were further confirmed by colony PCR, double digestion with same set of restriction of RE and finally validated through sequencing by T7 or gene specific primer (GSP). The vector pcDNATM3.0 was chosen for transient expression in HL-60 and MOLT-4 mammalian cell lines (BD Clontech, Palo Alto, CA; GeneTex, Inc. North America) under control of PCMV promoter. After confirmation in E.coli, the pcDNATM3.0::Molecule A, the entire cassette used to transfect HL-60 and MOLT-4 cell lines (BD Clontech, Palo Alto, CA).
The E2F3P1 is a pseudogene and its overexpression into HL-60 and MOLT-4 mammalian cell lines will affect the expression of ATG5 and BIRC5. The change in expression of ATG5 and BIRC5 can be studied by quantitative real time PCR (qRT-PCR). Total RNA was isolated from expanded clones by using RNaeasy Mini Kits (Qiagen, valenica, CA). The cDNa was synthesized by reverse transcription using PolyT primer (5-GCAAATACGACTCACTATAGGGATCCTTTTTTTTTTTTTTTT-3) using a SuperScript III kit (Invitrogen, Carlsbad, CA). The cDNA was PCR amplified using forward gene specific primers of Molecule A, B and C and reverse T7 primer (5-GCAAATACGACTCACTATAGGGATC-3) using AccuTaq DNA polymerase (Invitrogen). The relative fold expression will be calculated by using 2-delta delta cT method (Livak, 2003). The control here will be un-transfected HL-60 and MOLT-4 mammalian cell lines.’
The key examination to differentiate the mechanism accountable for an overexpression phenotype is by analysing the loss-of-function phenotype of the E2F3P1. Three consequences can be anticipated: loss-of-function could lead to either the reverse phenotype of overexpression, the similar phenotype, or null phenotype. The modest situation to understand is after overexpression and removal of E2F3P1 will cause opposite phenotypes (Prelich, 2012). This way the function of overexpressed and endogenous forms of molecule C can be identified.
Part B
Molecule B: baculoviral IAP repeat containing 5, located on Chromosome 17: 78,214,186-78,225,636forward strand, GRCh38:CM000679.2. This gene has 11 transcripts (splice variants),83 orthologues, is a member of1 Ensemble protein familyand is related with3 phenotypes. This gene is a member of the Human CCDS set:CCDS11755.1,CCDS32751.1,CCDS32752.1. This gene maps to76,210,267-76,221,717in GRCh37 coordinates. Localization: Cytoplasm, Nucleus, Chromosome, Chromosome, centromere. The BIRC5 gene has only one exon (1-352).
Molecule C: E2F3P1ENSG00000267046, E2F transcription factor 3 pseudogene, located on Chromosome 17: 35,490,009-35,491,238forward strand, GRCh38:CM000679.2, it has one transcript variant and it maps to33,817,028-33,818,257in GRCh37 coordinates. The entire gene sequence is a coding region therefore it has one exon. The molecule C shows subcellular distribution in cytoplasm and nucleus.
In-vivo Molecular Mechanism showing functions of each of individual genes A, B and C, along with the crosstalk amongst them
The in-silico model suggests that Molecule A interacts with several intercting partners and induces autophagy, while alone it is not able to do so. The molecule B is involved Anti-apoptosis, therefore the molecules performs almost similar functions. Whereas, the molecule C is a product of pseudogene, therefore it interfers with the functions of both molecules A and B. As the model suggests that upon transcription of molecule A and B, the translated product undergoes several post-translational modification prior to performing its function. Therefore, the working model suggest the putative roles of each of three molecules and how interaction between each of them affect their individual function.
This Engineeringassignment sample was powered by the assignment writing experts of Grade Saviours. You can free download this Engineering assessment answer for reference. This solved Engineering assignment sample is only for reference purpose and not to be submitted to your university. For a fresh solution to this question, fill the form here and get our professional assignment help.
1,212,718Orders
4.9/5Rating
5,063Experts
Turnitin Report
$10.00Proofreading and Editing
$9.00Per PageConsultation with Expert
$35.00Per HourLive Session 1-on-1
$40.00Per 30 min.Quality Check
$25.00Total
FreeGet
500 Words Free
on your assignment today
Get
500 Words Free
on your assignment today
Request Callback
Doing your Assignment with our resources is simple, take Expert assistance to ensure HD Grades. Here you Go....